Gene Signal Announces Positive Data From Phase 3 Trial of Aganirsen Eye Drops For Corneal Neovascularisation Due To Inflammation, A Rare Eye Disease With European Orphan Drug Designation
Lausanne, Switzerland, May 1 2 th 2014 – Gene Signal, a biotechnology company focused on developing innovative drugs to manage angiogenesis - based medical conditions, and the Department of Ophthalmology, University of Cologne Medical Centre, Germany, today announced that positive data from the I - CAN study of a ganirsen eye drops (GS - 101) was published in Ophthalmology, the Journal of the American Academy of Ophthalmology 1
The European Phase III study of sixty nine ( 69 ) patients was designed to test the efficacy and safety of a ganirsen, a first - in - class eye drop therapy , on patients who suffer from abnormal blood vessel growth in the front of the eye (corneal neovasculari s ation or CNV) due to inflammation (keratitis) . In order to prevent blindness, t hese patients may need to have the diseased cornea replaced with a new cornea, known as a graft. There are long waiting lists for this operation, and untreated CNV can lead to an inc reased rate of graft failure and rejection. Currently , there are no approved therapies for this indication , for which a ganirsen has an Orphan Drug D esignation in Europe.
The company has been working hand - in - hand with regulators and key opinion leaders over several years as the understanding and clinical best practice for this condition has developed. The next step for the company is to discuss the results of the I - CAN study with the regulatory authorities to design a short confirmatory and pivotal study .
Eric Viaud, CEO and Co - Founder of Gene Signal , commented: “We are very encouraged by these results which demonstrate that a ganirsen reduces corneal vascularisation and that it is safe. The data strongly support our experience since 2010 of using a ganirsen in named patient sales in four European countries, where the clinical benefit has been accepted. We are confident that these results will enable us to agree with the regulatory authorities a short confirmatory and pivotal study. Our goal is to move quickly to bring a much - needed therapy to the estimated 20,500 corneal neovascularisation graft patients across Europe . Aganirsen is set to become a break - through topical therapy for a range of ophthalmic diseases.”
Professor Claus Cursiefen, MD, Principal Investigator of the I - CAN Study and Head of Department of Ophthalmology, University of Cologne Medical Centre , Germany , said: “ Overall, the I - CAN study results demonstrate that a ganirsen has important clinical benefits as a novel topical therapy for patients who are awaiting corneal transplants. There is a real unmet patient need, as current therapies do not target neovascularisation, and the longer patients go untreated, the greater the risk of graft failure or rejection.”
“ The fact that the need for corneal transplantation was significantly reduced in patients with viral keratitis and central neovasculari s ation, and that topical application of a ganirsen was safe and well - tolerated, encourage us to continue clinical developme nt of this therapy , ” he added.
Encouraging Efficacy Results
Visual Acuity (VA) has been traditionally used as an efficacy measure for back of the eye diseases such as age - related macular degeneration ( AMD ) and diabetic retinopathy ( DR ) . The regulatory authorities recommended the I - CAN study to be the first randomised clinical trial in the front of eye disease CV to use VA as a primary endpoint. The results based on the whole patient population included in the study showed no statistical difference in VA scores between a ganirsen and placebo patient groups. This confirmed a systematic review of a weak link between CNV and VA (Bachman n et al 2013) 2 .
However the I - CAN study demonstrated a number of other efficacy results with positive data for topical aganirsen :
S ignificantly reduce d by 26.2% (p=0.014) the relative area of corneal neovasculari s ation after 90 days and this improvement persisted after 180 days
T ended to lower the need for cornea transplantation at day 180 (p=0.087) in the intent to treat (I TT ) population
However, i n th ose patients with viral keratitis (inflammation) and central neovasculari s ation, it significantly reduced the need for cornea transplantation at both day 90 (p=0.014) and at day 180 (p=0.012)
In those patients with traumatic/viral keratitis (inflammation), it tended to lower the risk of graft rejection at day 90 (p=0.162)
In terms of Quality of Life, there were significant improvements in composite and near activity sub scores (p=0.039 and 0.026 respectively) at day 90 in the per protocol a ganirsen population .
2 confirmatory and pivotal study. Our goal is to move quickly to bring a much - needed therapy to the estimated 20,500 corneal neovascularisation graft patients across Europe . Aganirsen is set to become a break - through topical therapy for a range of ophthalmic diseases.” Professor Claus Cursiefen, MD, Principal Investigator of the I - CAN Study and Head of Department of Ophthalmology, University of Cologne Medical Centre , Germany , said: “ Overall, the I - CAN study results demonstrate that a ganirsen has important clinical benefits as a novel topical therapy for patients who are awaiting corneal transplants. There is a real unmet patient need, as current therapies do not target neovascularisation, and the longer patients go untreated, the greater the risk of graft failure or rejection.” “ The fact that the need for corneal transplantation was significantly reduced in patients with viral keratitis and central neovasculari s ation, and that topical application of a ganirsen was safe and well - tolerated, encourage us to continue clinical developme nt of this therapy , ” he added. Encouraging Efficacy Results Visual Acuity (VA) has been traditionally used as an efficacy measure for back of the eye diseases such as age - related macular degeneration ( AMD ) and diabetic retinopathy ( DR ) . The regulatory authorities recommended the I - CAN study to be the first randomised clinical trial in the front of eye disease CV to use VA as a primary endpoint. The results based on the whole patient population included in the study showed no statistical difference in VA scores between a ganirsen and placebo patient groups. This confirmed a systematic review of a weak link between CNV and VA (Bachman n et al 2013) 2 . However the I - CAN study demonstrated a number of other efficacy results with positive data for topical aganirsen : ? S ignificantly reduce d by 26.2% (p=0.014) the relative area of corneal neovasculari s ation after 90 days and this improvement persisted after 180 days ( reduction of 26.6%, p=0.012) ? T ended to lower the need for cornea transplantation at day 180 (p=0.087) in the intent to treat (I TT ) population ? However, i n th ose patients with viral keratitis (inflammation) and central neovasculari s ation, it significantly reduced the need for cornea transplantation at both day 90 (p=0.014) and at day 180 (p=0.012) ? In those patients with traumatic/viral keratitis (inflammation), it tended to lower the risk of graft rejection at day 90 (p=0.162) ? In terms of Quality of Life, there were significant improvements in composite and near activity sub scores (p=0.039 and 0.026 respectively) at day 90 in the per protocol a ganirsen population . Ocular TEAEs were lower in a ganirsen patients (11.1%) compared to placebo patients (18.4%) ? Most TEAEs were of mild or moderate severity and there was no evidence of increased incidence of severe TEAEs in either patient group ? Patient complia nce was 95% for a ganirsen patients, a remarkable result for such a painful ophthalmologic condition . About the I - CAN Study I - CAN is the first randomised trial of a topical inhibitor of corneal angiogenesis . It was a European multicentre, double - masked, randomised placebo - controlled Phase III study. Sixty nine ( 69 ) patients with keratitis - related progressive corneal neovasculari s ation (CNV) were randomi s ed to receive a ganirsen (34) or placebo (35). Patients applied a ganirsen eye drops (GS - 101) with one dr op twice a day of a 86 mg/ml solution or placebo, for 90 days treatment with a follow up at 180 days. Aganirsen was administered on top of current standard of care (e.g. corticoids, antiviral and immunosuppressant therapies). The I - CAN study results have been published online in Ophthalmology , the Journal of the American Academy of Ophthalmology ( http://www.aaojournal.org/article/S0161 - 6420(14)0031 5 - 7/abstract ) About C orneal N eovascularisation in G raft P atients Corneal transplantation , or replacement of a patient’s damaged cornea with that of a donor cornea (graft) , has a relatively high success rate . This is attributable to the privilege d “ immune status ” of the cornea, which reduces rejection episodes common in other organ transplant situations. However , w hen sickly and leaky blood vessels invade the cornea – a condition known as p athologic corneal neovascularisation (CNV) - the situation changes, and the risk of graft rejection is again much higher. This is because the unwanted pathological vessels reduce the cornea’s privilege d immune status . In fact, a recent meta - analysis confirmed the association between presence of pathological corneal neovessels and increased risk of graft rejection . C onsequently, and because of the long graft waiting lists that patients are faced with both in Europe and in the USA, it is desirable to apply a therapy such as a ganirsen to reduce corneal neovascularisatio n and hence the risk of graft rejection. In Europe alone, there are an estimated 20,500 patients suffering from CNV. About Aganirsen Antisense Oligonucleotide Gene Signals’ compound, a ganirsen (GS - 101) , is a novel compound which is applied topically, i.e. in eye - drop formulation for front of the eye diseases and in eye - emulsion formulation for back of the eye diseases such as neovascular glaucoma. It has the ability to inhibit unwanted angiogenesis. Early signs are that a ganirsen, an antisense DNA oligonucleotide, 3 is topically effective. Formulated as a small complementary DNA fragment, a ganirsen emulsion has demonstrated its ability to effectively inhibit neovascularisation in the cornea and to reach and act on the retina 4 , when other drugs have t o be injected. Aganirsen inhibits the insulin receptor substrate 1 (IRS - 1) which is over - expressed in pathological angiogenesis, 5 and it has been demonstrated to target pathological vessels without inhibiting normal vessel growth . 6 Thanks to its entirely novel mechanism of action, 4 this could potentially make a ganirsen a topical and safe alternative to anti - VEGF intra - vitreal injections depending on the indication. Additionally, antisense oligonucleotides confer distinctive advantages versus other biologic s: they can be readily diffused across cell membranes, are associated with low immunogenicity, and can be produced by simple chemical synthesis, unlike larger proteins and monoclonal antibodies that require cell culture and complex purification steps. Abo ut Gene Signal www.genesignal.com Gene Signal is a Swiss - based biotechnology company pioneering the development of innovative therapies for angiogenesis - based diseases. Its product candidates are a new class of oli gonucleotides, proteins and monoclonal antibodies which are derived from genes that are exclusively involved in the angiogenesis process. At least f our official candidates are in development for eleven indications in ophthalmology, dermatology, vascular di sorders and cancer. The company’s lead compound, a ganirsen (GS - 101), an antisense DNA oligonucleotide, completed in 2013 the European I - CAN Phase III trial for the treatment of corneal neovascular isation due to inflammation . The I - CAN study was published in 2014 and the company is planning a short confirmatory pivotal trial to lead to market authorisation. Aganirsen is the beneficiary of an EU grant for the Phase II STRONG trial for the treatment of ischemic central retinal ve in occlusion ( i CRVO). The compound is also being prepared for Phase II proof of concept (P o C) trials in age - related macular degeneration (AMD) and diabetic macular oedema (DME). F ollowing a successful P o C study published in 2014 , a larger Phase II trial is planned in Psoriasis.
G ene Signal’s discovery program leverages a patented discovery platform, GENE - MAAP, which streamlines the identification process of genes exclusively involved in the regulation of angiogenesis, resulting in the identification and pa tenting of more than 94 such genes.
The company was founded in 2000, is privately owned, and is led by a team of highly qualified scientific and commercial talents. Its headquarters are in Lausanne (EPFL Swiss Federal Institute of Technology), Switzerland, with research programs based in France (Bioparc Genopole, Evry) and product development in Canada (Montreal).
Media Contacts : Prof Claus Cursiefen Gene Signal claus.cursiefen@uk - koeln.de Eric Viaud, CEO and co - Founder ev@genesignal.com Media –
1 Cursiefen C. et al “Aganirsen antisense oligonucleotide eye drops inhibit keratitis - induced corneal neovascularization and reduce need for transplantation: the I - CAN study” Ophthalmology , e - pub 08 May 2014, http://www.aaojournal.org/article/S0161 - 6420(14)00315 - 7/fulltext 2 Bachmann B, Taylor RS, Cursiefen C. The association between corneal neovascularization and visual acuity: a systematic review. Acta Ophthalmol February 2013;91:12 - 9. 3 An antisense Oligonucleotide is a short strand of DNA designed to prevent translation of messenger RNA into an unwanted protein 4 Cloutier F, Lawrence M. et al “Anti - angiogenic activity of Aganirsen in non - human primate and rodent models of retinal neovascular disease following topical administration” Invest. Ophthalmol. Vis. Sci. (IOVS) February 9, 2012 iovs.11 - 9064 5 Al Mahmood S et al “Potent in vivo antiangiogenic effects of GS - 101 (5' - TATCCGGAGGGCTCGCCATGCTGCT - 3'), an antisense oligonucleotide preventing the expression of insulin receptor substrate - 1”, J. Pharmacol Exp Ther. (JPET) 2009 May;329(2):496 - 504. 6 Cloutier F. IOVS 2012
Help employers find you! Check out all the jobs and post your resume.
