BioSpace Collaborative

Academic/Biomedical Research
News & Jobs
Biotechnology and Pharmaceutical Channel Medical Device and Diagnostics Channel Clinical Research Channel BioSpace Collaborative    Job Seekers:  Register | Login          Employers:  Register | Login  

Free Newsletters
My Subscriptions

News by Subject
News by Disease
News by Date
Search News
Post Your News

Job Seeker Login
Most Recent Jobs
Search Jobs
Post Resume
Career Fairs
Career Resources
For Employers

Regional News
US & Canada
  Biotech Bay
  Biotech Beach
  Pharm Country
  Bio NC
  Southern Pharm
  BioCanada East
  C2C Services & Suppliers™


Company Profiles

Research Store

Research Events
Post an Event
Real Estate
Business Opportunities

PLoS By Category | Recent PLoS Articles
Biochemistry - Biotechnology - Pharmacology - Urology

Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle
Published: Friday, November 30, 2012
Author: Martin Hennenberg et al.

by Martin Hennenberg, Frank Strittmatter, Christer Beckmann, Beata Rutz, Claudius Füllhase, Raphaela Waidelich, Francesco Montorsi, Petter Hedlund, Karl-Erik Andersson, Christian G. Stief, Christian Gratzke


The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs.


To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective a1A-adrenoceptor antagonist, silodosin, on transcription factor activation.


Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA).


Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and a-smooth muscle actin (aSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues.


Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of a1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.
